1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2021/22

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Cvičenia vo štvrtok o 14:00 sú určené pre študentov BIN, INF, mINF, mAIN, DAV. Cvičenia vo štvrtok o 17:20 sú pre študentov z PriFUK a z fyzikálnych odborov. Obidvoje cvičenia sa budú konať už v prvom týždni semestra.


CB10: Rozdiel medzi revíziami

Z MBI
Prejsť na: navigácia, hľadanie
(Nussinovovej algoritmus)
(RNA štruktúra)
Riadok 20: Riadok 20:
  
 
* Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?
 
* Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?
 
==RNA štruktúra==
 
* Znama databaza rodin RNA genov je Rfam: http://rfam.xfam.org/
 
* Najdite si v nej rodinu RF00015 (U4 spliceosomal RNA)
 
* V casti Secondary structure si mozete pozriet obrazky farebne kodovane podla roznych kriterii
 
** Skuste pochopit, co jednotlive obrazky a ich farby znamenaju
 
* Jedna z mnohych ludskych kopii je tato:
 
<pre>
 
AGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCG
 
ATTATTGCTAATTGAAAACTTTTCCCAATACCCCGCCATGACGACTTGAA
 
ATATAGTCGGCATTGGCAATTTTTGACAGTCTCTACGGAGA
 
</pre>
 
* Skuste ju najst v ludskom genome nastrojom BLAT v [http://genome-euro.ucsc.edu UCSC genome browseri]
 
* Pozrite si tracky GENCODE genes, conservation, RepeatMasker v jej okoli
 
* Vo verzii hg19 (kam sa viete z inej verzii dostat cez horne menu View->In Other Genomes) je track "CSHL Sm RNA-seq" ktory obsahuje RNASeq kratkych RNA z roznych casti buniek, zapnite si v jeho nastaveniach aj zobrazenie RNA z jadra (nucleus)
 
* Zadajte sekvenciu na RNAfold serveri [http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi]
 
* Ak vypocet dlho trva, pozrite si vysledok [http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi?PAGE=3&ID=fdr_TwjicB tu]
 
* Podoba sa na strukturu zobrazenu v Rfame? v com sa lisi?
 
 
* RNA dizajn: mozete sa skusit zahrat na stranke http://www.eternagame.org/web/
 

Verzia zo dňa a času 14:26, 3. december 2020

Nussinovovej algoritmus

Z cvičných príkladov na skúšku

  • Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
 G A A C U U C A C U G A
 0 0 0 1 1 2 3 3 3 4 4 4  G
   0 0 0 1 2 2 2 2 3 4 4  A
     0 0 1 1 1 2 2 2 3 4  A
       0 0 0 0 1 1 1 2 3  C
         0 0 0 1 1 1 2 3  U
           0 0 1 1 1 2 3  U
             0 0 0 1 2 2  C
               0 0 1 1 1  A
                 0 0 1 1  C
                   0 0 1  U
                     0 0  G
                       0  A
  • Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?