1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2021/22

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Cvičenia vo štvrtok o 14:00 sú určené pre študentov BIN, INF, mINF, mAIN, DAV. Cvičenia vo štvrtok o 17:20 sú pre študentov z PriFUK a z fyzikálnych odborov. Obidvoje cvičenia sa budú konať už v prvom týždni semestra.


CB10

Z MBI
Prejsť na: navigácia, hľadanie

Nussinovovej algoritmus

Z cvičných príkladov na skúšku

  • Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
  • Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?

RNA štruktúra

  • Znama databaza rodin RNA genov je Rfam: http://rfam.xfam.org/
  • Najdite si v nej rodinu RF00015 (U4 spliceosomal RNA)
  • V casti Secondary structure si mozete pozriet obrazky farebne kodovane podla roznych kriterii
    • Skuste pochopit, co jednotlive obrazky a ich farby znamenaju
  • Jedna z mnohych ludskych kopii je tato:
AGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCG
ATTATTGCTAATTGAAAACTTTTCCCAATACCCCGCCATGACGACTTGAA
ATATAGTCGGCATTGGCAATTTTTGACAGTCTCTACGGAGA
  • Skuste ju najst v ludskom genome nastrojom BLAT v UCSC genome browseri
  • Pozrite si tracky GENCODE genes, conservation, RepeatMasker v jej okoli
  • Vo verzii hg19 (kam sa viete z inej verzii dostat cez horne menu View->In Other Genomes) je track "CSHL Sm RNA-seq" ktory obsahuje RNASeq kratkych RNA z roznych casti buniek, zapnite si v jeho nastaveniach aj zobrazenie RNA z jadra (nucleus)
  • Zadajte sekvenciu na RNAfold serveri [1]
  • Ak vypocet dlho trva, pozrite si vysledok tu
  • Podoba sa na strukturu zobrazenu v Rfame? v com sa lisi?