1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2022/23

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Quizzes can be found in Moodle.
Homework assignments and journal club papers can be found in Tasks and dates.
Groups for journal club have each their own channel in MS Teams.


CI-en-db

Z MBI
Prejsť na: navigácia, hľadanie

Úvod do bioinformatických databáz a on-line nástrojov

NCBI, Genbank, Pubmed, blast

  • National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/
  • Zhromazduje verejne pristupne data z molekularnej biologie
  • Mozeme hladat klucove slova v roznych databazach
    • Pubmed: databaza clankov, napr. najdime phastcons
    • Gene: najdime DNA polymerazu
    • BLAST: najdime nasledujucu sekvenciu v genome kurata (zvoľme nucleotide blast, database others a z menu reference genomic sequence, organism chicken (taxid:9031), program blastn)
    • Ide o osekvenovany kusok ludskej mRNA, kde v kuracom genome sme nasli homolog, ake ma dlzku, skore, E-value, % zhodnych baz?
AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA
AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC
GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA
CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC
CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC
AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA
GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG
TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC
TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC
ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG
GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC
CCGAAAAGCCCCCACAAAAAGCCG

Uniprot

  • Prehladnejsi pohlad na proteiny, vela linkov na ine databazy, cast vytvarana rucne
    • Pozrieme sa na enzým Bis(5'-adenosyl)-triphosphatase
    • Nájdime ho na stránke http://www.uniprot.org/ pod názvom FHIT_HUMAN
    • Pozrime si podrobne jeho stránku, ktoré časti boli predpovedané bioinformatickými metódami z prednášky?
    • Všimnime si Pfam doménu a pozrime si jej stránku, do akej super-rodiny (klanu) patrí?

UCSC genome browser

Sekvenovanie

  • Hore v modrom menu zvoľte Genomes
  • Na ďalšej stránke zvoľte človeka a v menu Assembly zistite, kedy boli pridané posledné dve verzie ľudského genómu (hg19 a hg38)
  • Na tej istej stránke dole nájdete stručný popis zvolenej verzie genómu. Pre ktoré oblasti genómu máme v hg19 viacero alternatívnych verzií?
  • Zadajte región chr21:31,200,000-31,350,000 v hg19
  • Zapnite si tracky Mapability a RepeatMasker na "full"
  • Mapability: nakoľko sa daný úsek opakuje v genóme a či teda vieme jednoznačne jeho ready namapovať pri použití Next generation sequencing
  • Ako a prečo sa pri rôznych dĺžkach readov líšia? (Keď kliknete na linku "Mapability", môžete si prečítať bližšie detaily.)
  • Približne v strede zobrazeného regiónu je pokles mapovateľnosti. Akému typu opakovania zodpovedá? (pozrite track RepeatMasker)
  • Zapnite si tracky "Assembly" a "Gaps" a pozrite si región chr2:110,000,000-110,300,000. Aká dlhá je neosekvenovaná medzera (gap) v strede tohto regiónu? Približnú veľkosť môžete odčítať z obrázku, presnejší údaj zistíte kliknutím na čierny obdĺžnik zodpovedajúci tejto medzere (úplne presná dĺžka aj tak nebola známa, nakoľko nebola osekvenovaná).

Geny

  • Zvolte starsiu verziu ludskeho genomu hg18, ktora ma viac informacii
  • Do okienka position zadajte gen MAGEA2B a potom zvolte jeden jeho vyskyt (ma dva vyskyty)
    • Dostanete sa tam aj touto linkou: [1]
  • Ak date 3x zoom out, mozete si vsimnut, ze tento gen ma viacero foriem zostrihu, ktore sa ale lisia iba v 5' UTR
  • Vela veci sa mozete dozvediet klikanim na rozne casti broswera: napr, kliknutim na gen si mozete precitat o jeho funkcii, kliknutim na listu ku tracku (lavy okraj obazku) sa dozviete viac o tracku a mozete nastavovat parametre zobrazenia

Komparativna genomika

  • V casti multiz alignments vidite zarovnania k roznym inym genomom (da sa zapinat, ze ku ktorym). Mozete si pozriet, ako sa uroven zarovnania zmeni ked sa priblizujeme a vzdalujeme (zoom in/zoom out).
  • Ked sa priblizite spat na gen MAGEA2B a potom tak, aby ste boli na urovni "base", t.j. zobrazenych cca 100bp, v obdlzniku multiz alignment uvidite zarovnanie s homologickym usekom v inych genomoch. Konkretne v MAGEA2B vidime pomerne dost rozdielov v proteine medzi clovekom a makakom rezus, vdaka ktorym bol zrejme klasifikovany ako pod pozitivnym vyberom.
  • V casti conservation by PhyloP vidime graf toho, ako silne su zachovane jednotlive stlpce zarovnania
  • Da sa zapnut track Placental Chain/Net a pozriet sa na ktorych chromozomoch je ortologicky usek v inych genomoch

Blat

  • Choďte na UCSC genome browser (http//genome.ucsc.edu/), na modrej lište zvoľte BLAT, zadajte DNA sekvenciu vyssie a hľadajte ju v ľudskom genóme. Akú podobnosť (IDENTITY) má najsilnejší nájdený výskyt? Aký dlhý úsek genómu zasahuje? (SPAN). Všimnite si, že ostatné výskyty sú oveľa kratšie.
  • V stĺpci ACTIONS si pomocou Details môžete pozrieť detaily zarovnania a pomocou Browser si pozrieť príslušný úsek genómu.
  • V tomto úseku genómu si zapnite track Vertebrate net na full a kliknutím na farebnú čiaru na obrázku pre tento track zistite, na ktorom chromozóme kuraťa sa vyskytuje homologický úsek.
  • Skusme tu istu sekvenciu namapovat do genomu sliepky: stlacte najprv na hornej modrej liste Genomes, zvolte Vertebrates a Chicken a potom na hornej liste BLAT. Do okienka zadajte tu istu sekvenciu. Akú podobnosť a dĺžku má najsilnejší nájdený výskyt teraz? Na ktorom je chromozóme?
  • Ako sa to porovna s hodnotami, ktore sme dostali pomocou BLASTu na NCBI?

Objavenie génu HAR1 pomocou komparatívnej genomiky

  • Pollard KS, Salama SR, Lambert N, et al. (September 2006). "An RNA gene expressed during cortical development evolved rapidly in humans". Nature 443 (7108): 167–72. doi:10.1038/nature05113. PMID 16915236. pdf
  • Zobrali všetky regióny dĺžky aspoň 100bp s > 96% podobnosťou medzi šimpanzom a myšou/potkanom (35,000)
  • Porovnali s ostatnými cicavcami, zistili, ktoré majú veľa mutáci v človeku, ale málo inde (pravdepodobnostný model)
  • 49 štatisticky významných regiónov, 96% nekódujúcich oblastiach
  • Najvýznamnejší HAR1: 118nt, 18 substitúcii u človeka, očakávali by sme 0.27. Iba 2 zmeny medzi šimpanzom a sliepkou (310 miliónov rokov), ale nebol nájdený v rybách a žabe.
  • Nezdá sa byť polymorfný u človeka
  • Prekrývajúce sa RNA gény HAR1R a HAR1F
  • HAR1F je exprimovaný v neokortexe u 7 a 9 týždenných embrií, neskôr aj v iných častiach mozgu (u človeka aj iných primátov)
  • Všetky substitúcie v človeku A/T->C/G, stabilnejšia RNA štruktúra (ale tiež sú blízko k telomére, kde je viacej takýchto mutácii kvôli rekombinácii a biased gene conversion)
  • Môžete si pozrieť tento region v browseri: chr20:61,203,911-61,204,071 (hg18), pricom ak sa este priblizite, uvidite zarovnanie aj s bazami a mozete vidiet, ze vela zmien je specifickych pre cloveka
  • Vynimkou je slon, niektore zmeny v slonovi su sposobene nizkou kvalitou sekvencie. Ked pomocou nastroja In other genomes (convert) v polozke View na hornej liste premapujete do novsej verzie ludskeho genomu (hg19), uvidite, ze aj v najnovsej verzii genomu slona su mnohe zmeny, nechyba tam uz vsak cast sekvencie, ako vo verzii pouzitej v hg18.

Práca s tabuľkami, sťahovanie anotácií

  • Položka Tables na hornej lište umožnuje robiť rafinované veci s tabuľkami, ktoré obsahujú súradnice génov a pod.
  • Základná vec: vyexportovať napr. všetky gény v zobrazenom výseku v niektorom formáte:
    • sequence: fasta súbor proteínov, génov alebo mRNA s rôznymi nastaveniami
    • GTF: súradnice
    • Hyperlinks to genome browser: klikacia stránka
  • Namiesto exportu si môžeme pozrieť rôzne štatistiky
  • Zložitejšie: prienik dvoch tabuliek, napr. gény, ktoré sú viac než 50% pokryté simple repeats
    • V intersection zvolíme group: Variation and repeats, track: RepeatMasker, nastavíme records that have at least 50% overlap with RepeatMasker
    • V summary/statistics zistíme, kolko ich je v genóme, môžeme si ich preklikať cez Hyperlinks to genome browser
  • Filter na tabuľku, napr. gény, ktoré majú v názve ribosomal (postup pre drozofilu):
    • V casti hg19.kgXref based filters políčko description dáme *ribosomal*

Populacna genomika v UCSC genome browseri

UCSC genome browser ma viacero trackov tykajucich sa populacnej genomiky a polymorfizmov

  • Pozrite si napriklad region chr2:174,862-436,468 v hg19
  • V casti Phenotype and Disease Associations si zapnite GAD view
  • V casti Variation and Repeats si zapnite
    • HGDP Allele Freq na Pack (po kliknuti na SNP zobrazi mapu sveta s distribuciou alel)
    • "DGV Struct Var" na Pack
  • Track Genome Variants obsahuje genomy niekolkych ludi, napr Jima Watsona
  • Takisto sa da pozriet genom ludi z jaskyne Denisova a Neandertalcov

V starsej verzii ludskeho genomu je aj trojuholnikovy graf linkage disequilibria

  • region vyssie premapovany do hg18
  • zapnite "HapMap LD Phased" na Full (cast Variation and Repeats)
  • vsimnite si, ze miery LD sa medzi ludskymi podpopulaciami lisia (YRI: Nigeria; CEU: Europa; JPT+CHB: Japonsko, Cina)

Browser diverzity u S.cerevisae:

Fylogeneticke stromy, mobyle portal

  • V UCSC browseri mozeme ziskavat viacnasobne zarovnania jednotlivych genov (nukleotidy alebo proteiny). Nasledujuci postup nemusite robit, subor si stiahnite tu: http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb06/cb06-aln.fa
    • UCSC browseri si pozrieme usek ludskeho genomu chr6:136,214,527-136,558,402 s genom PDE7B (phosphodiesterase 7B)
    • Na modrej liste zvolime Tables, v nej RefSeq genes, zaklikneme Region: position, a Output fomat: CDS FASTA alignment a stlacime Get output
    • Na dalsej obrazovke zaklikneme show nucleotides. Z primatov zvolime chimp, rhesus, tarsier, z inych cicavcov mouse, rat, dog, elephant a z dalsich organizmov opposum, platypus, chicken, lizard, stlacime Get output.
    • Vystup ulozime do suboru, z mien sekvencii zmazeme spolocny prefix NM_018945_, pripadne celkovo prepiseme mena na anglicke nazvy
  • Skusme zostavit strom na stranke http://mobyle.pasteur.fr/cgi-bin/portal.py
  • Pouzijeme program quicktree, metodu neighbor joining, bootstrap 100
  • Na zobrazenie stromu vysledok dalej prezenieme cez zobrazovacie programy drawtree alebo newicktops (zvolit v menu pri tlacidle further analysis)
    • Vysledok z drawtree, nezakoreneny, nezobrazuje bootstrap hodnoty
    • Vysledok z newicktops, zakoreneny na nahodnom mieste (nie spravne) zobrazuje bootstrap hodnoty
    • v drawtree sme nastavili sme formát výstupu MS-Windows Bitmap a X,Y resolution aspoň 1000, v newicktops sme nastavili show bootstrap values
  • "Spravny strom" [3] v nastaveniach Conservation track-u v UCSC browseri (podla clanku Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51.)
  • Nas strom ma long branch attraction (zle postavenie hlodavcov, ktori maju dlhu vetvu aj slona, co moze byt zapricene sekvenovacimi chybami).
  • Ine programy, ktore mozete skusit na mobyle
    • phyml: metoda maximalnej vierohodnosti (daju sa nastavit detaily modelu, bootstraps, ktory ale moze dost dlho trvat, typy operacii na strome pri heuristickom hladani najlepsieho stromu)
    • dnapars alebo protpars na parsimony
    • viacnasobne zarovnanie pomocou clustalw alebo modernejsou alternativou muscle
    • Ak chcete skusat zarovnania, zacnite z nezarovnanych sekvencii: http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb06/cb06-seq.fa

Gene expression

Data o expresii ludskych genov v roznych tkanivach a podobne v UCSC genome browseri

  • Chodte na stranku http://genome.ucsc.edu/, najdite PTPRZ1 gen v ludskom genome
  • Zvolte Tools->Gene Sorter, sort by nechajme Expression (GNF Atlas 2), search PTPRZ1
    • Dostane tabulku genov s podobny profilom expresie ako PTPRZ1 (červená je vysoká expresia, zelená nízka)
  • Chceme zistiť, či v tomto zozname je nadreprezentovaná nejaká funkčná kategória
    • Potrebujeme najskôr získať zoznam genov bez dalsich udajov
    • Stlacte configure, tlacidlom hide all zrusite vsetky zaskrtnute typy informacie a zakrtnite iba Name, stlačíte submit
    • Potom stlačte tlačidlo text a dostanete čisto zoznam mien génov v textovom formáte
    • V prípade problémov ho nájdete ho aj tu
  • http://biit.cs.ut.ee/gprofiler/ mena genov skopirujme do policka Query, stlacte g:Profile!
    • Vo vyslednej tabulke je kazdy riadok jedna funkcna kategoria, v ktorej su geny s tymto profilom expresie nadreprezentovane, kazdy stlpec jeden gen. Mena kategorii su uplne vpravo.
  • Co by sme na zaklade nadreprezentovanych kategorii usudzovali o tomto gene?
  • Najdite tento gen v Uniprote (http://www.uniprot.org/), potvrdzuje nase domnienky?
  • Vratme sa do genome browsera, najdime si PTPRZ1 gen v genome
  • V browseri su rozne tracky tykajuce sa expresie, napr. GNF Atlas 2. Precitajte si, co je v tomto tracku zobrazene, zapnite si ho a pozrite si expresiu okolitych genov okolo PTPRZ1
  • Kliknite na gen v tracku UCSC known genes. V tabulke uvidite zase prehlad expresie v roznych tkanivach (podla GNF Atlasu), linku na Visigene.

NCBI Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/

  • Databaza gene expression dat na NCBI
  • Do okienka Data sets zadajme GDS2925
  • Mali by sme dostat Various weak organic acids effect on anaerobic yeast chemostat cultures
  • Mozeme si pozriet zakladne udaje, napr. citation, platform
  • Link "Expression profiles" nam zobrazi grafy pre rozne geny
  • Pri kazdom profile mozeme kliknut na profile neighbors, aby sme videli geny s podobnym profilom
  • Data analysis tools, cast Cluster heatmaps, K-means, skuste rozne pocty clustrov

Sekvenčné motívy, program MEME

  • Vazobne miesta transkripcnych faktorov sa casto reprezentuju ako sekvencne motivy
  • Ak mame skupinu sekvencii, mozeme hladat motiv, ktory maju spolocny
  • Znamy program na tento problem je MEME
  • Chodte na stranku http://meme.nbcr.net/
  • Zvolte nastroj MEME a do okienka "actual sequences" zadajte tieto sekvencie
  • Pozrite si ostatne nastavenia. Co asi robia?
  • Ak server pocita dlho, mozete si pozriet vysledky tu