CI-en-db: Rozdiel medzi revíziami

Verzia zo dňa a času 12:56, 25. marec 2015

Introduction to bioinformatics databases and on-line tools

The goal of this excercise is to

• see results of bioinformatics research in the form of on-line tools used by many biologists
• get to know some basic tools in case you might want to try your algorithms on biology data
• review some of the topics from the lectures

NCBI, Genbank, Pubmed, blast

• National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/
• Collects publicly available data in molecular biology
• We can search for keywords in various databases
• BLAST finds alignments of query sequence and a specified sequence database
  • convenient, because no need to download large database, but also very slow
• Try sequence below at http://blast.ncbi.nlm.nih.gov/Blast.cgi
  • the sequence is from the human genome but we will try to find its homolog in chicken
  • choose nucleotide blast, database reference genomic sequence, organism chicken (taxid:9031), program blastn)
  • on which chromosome is the best chicken homolog, what is alignment length, score, E-value, identity level?

AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA
AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC
GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA
CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC
CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC
AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA
GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG
TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC
TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC
ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG
GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC
CCGAAAAGCCCCCACAAAAAGCCG

UCSC genome browser

• http://genome.ucsc.edu/
• nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented
• also allows custom queries and data download

Basics

• on the front page choose Genomes in the top blue menu bar
• select genome and its version, optionally enter position or keyword, press submit
• on the browser screen top image shows chromosome map, selected region in red
• below a view of selected region and various track with information pertaining to these regions
• tracks can be switched on and off and configured in the bottom part of the page
  • different display levels, full contains all information but takes a lot of vertical space
• navigation at the top (move, zoom, etc.)
• various actions in the menu
• clicking at the browser figure allows you to get more information

Blat

• Instead of BLAST, UCSC genome browser uses faster but less sensitive BLAT (good for the same or very closely related species)
• Go to http//genome.ucsc.edu/, choose Blat in the top blue menu bar, enter DNA sequence above, search in the human genome
  • What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter)
  • Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region
• Go to the browser, switch on Vertebrate net/chain on full
  • this track allows you to move to corresponding parts of other genomes
  • in the chicken chain notice chromosome number of the corresponding region in chicken
• Optionally, you can try to use BLAT to map the query to the chicken genome directly
  • on the blue bar press genomes, choose vertebrate and chicken, then blat on the top bar in submenu Tools
  • what is not idemtity level and span of the best match? Is it on the same chromosome? How does it compare with the values obtained at NCBI?

Sequencing and assembly

• UCSC genome browser has numbered version of individual genomes - errors and missing parts are fixed over time
• Go to genome.ucsc.edu, choose Genomes in the Blue bar, select human, see when were the last version of the human genome added
  • if you are interested in detail, each assembly has a description at the bottom of the page
• Go to the browser for human assembly hg19, region chr2:110,000,000-110,300,000, you can use this link: [1]
• Display tracks "Assembly" and "Gap" in the full mode.
  • What is the length of the unsequenced gap in the middle? (you can click on the gap to get details; only an estimate, not sequenced in this assembly)
  • This gap is closed in the most recent assembly hg38. You can have a look by transfering to corresponding region in hg38 - click on the blue bar View -> In other genomes (convert), seelect hg38. Notice that the length of the region shrank from 300,000 to 158,880. So the gap length estimate was not very accurate.

Comparative genomics

Background: HAR1 gene

• Pollard KS, Salama SR, Lambert N, et al. (2006). "An RNA gene expressed during cortical development evolved rapidly in humans". Nature 443 (7108): 167–72. doi:10.1038/nature05113. pdf
• Authors found regions with many human-specific mutations but conserved in other mammals (using probabilistic models)
• 49 statistically significant regions
• The most significant is HAR1: length 118, 18 substitutions in human, expected value 0.27. Only 2 substitutions between chimpanzee and chicken.
• Overlaps RNA gene HAR1 (multiple forms)
• One of the forms is expessed in embryonic neocortex and other parts of the brain

HAR1 and comparative genomics in the browser

• You can see this region in the browser: chr20:61,733,466-61,733,626 (hg19)
• Make sure Conservation track is switched on full mode (perhaps press default tracks button)
• If you zoom in closer, you will see a multiple sequence alignment, with many changes specific to human
• If you zoom out to a wider region, e.g. chr20:61,733,305-61,733,787, you can look at PhyloP substrack which shows for every base its conservation level - increase conservation over mammals in general in the HAR1 region

Population genomics in the browser

Population genomics studies differences between individuals within species, e.g. between different people

• Go to region chr2:174,862-436,468 in hg19
• In section Phenotype and Disease Associations set GAD view track to full
  • This track shows knows associations of particular genetic regions or mutations to diseases
  • You can e.g. look at details of associations for gene ACP1

• In section Variation set HGDP Allele Freq to pack
  • Shows posotions were people differ from each other
  • after clicking on a particular position you get a world map with distribution of variant frequencies in different human populations
• Browser also contains tracks displaying genomes of specific people (e.g. Jim Watson) or ancient humans (Neandertals, Denisovans)

Work with tables, downloading data

Genome borwser is nice for manual browsing but also allows programmers to download data

• each track based on one or several tables in an SQL database
• you can download genomic sequences and data from these tables [2]
• you can also write queries for a public SQL server [3] or create queries using Table browser forms (blue bar: Tools->Table browser)

Table browser examples

• Basic type of query: e.g. export all genes in the part of the genome displayed in the browser
• Several output formats, e.g.:
  • sequence: file of protein or DNA sequences of these genes (various settings)
  • GTF: coordinates of genes and their exons
  • Hyperlinks to genome browser: list of genes with links to the browser for each gene
  • Instead of expoert we can get summary statistics (number of items, how much sequence they cover)
• More complex query, "intersection" of two tables: e.g. all genes that are more than 50% covered by simple repeats

Phylogenetic trees, mobyle portal

Preparing data, you can skip this part

• UCSC browser allows us to download multiple alignments of individual genes (DNA or protein sequences). Skip the following steps, the resulting alignment can be downloaded here: http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb06/cb06-aln.fa
  • In UCSC browser find gene PDE7B (phosphodiesterase 7B)
  • In the blue bar choose Tools->Table browser, track RefSeq genes, select Region: position, and Output fomat: CDS FASTA alignment and press Get output
  • At the next screen select show nucleotides. From primates select chimp, rhesus, tarsier, from other mammals mouse, rat, dog, elephant and from other species opposum, platypus, chicken, lizard, press Get output.
  • Output store on a file, remove common prefix NM_018945_ from sequence names, or completely rewrite species names

Building tree

• Skusme zostavit strom na stranke http://mobyle.pasteur.fr/cgi-bin/portal.py
• Pouzijeme program quicktree, metodu neighbor joining, bootstrap 100
• Na zobrazenie stromu vysledok dalej prezenieme cez zobrazovacie programy drawtree alebo newicktops (zvolit v menu pri tlacidle further analysis)
  • Vysledok z drawtree, nezakoreneny, nezobrazuje bootstrap hodnoty
  • Vysledok z newicktops, zakoreneny na nahodnom mieste (nie spravne) zobrazuje bootstrap hodnoty
  • v drawtree sme nastavili sme formát výstupu MS-Windows Bitmap a X,Y resolution aspoň 1000, v newicktops sme nastavili show bootstrap values
• "Spravny strom" [4] v nastaveniach Conservation track-u v UCSC browseri (podla clanku Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51.)
• Nas strom ma long branch attraction (zle postavenie hlodavcov, ktori maju dlhu vetvu aj slona, co moze byt zapricene sekvenovacimi chybami).
• Ine programy, ktore mozete skusit na mobyle
  • phyml: metoda maximalnej vierohodnosti (daju sa nastavit detaily modelu, bootstraps, ktory ale moze dost dlho trvat, typy operacii na strome pri heuristickom hladani najlepsieho stromu)
  • dnapars alebo protpars na parsimony
  • viacnasobne zarovnanie pomocou clustalw alebo modernejsou alternativou muscle
  • Ak chcete skusat zarovnania, zacnite z nezarovnanych sekvencii: http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb06/cb06-seq.fa

Gene expression

Data o expresii ludskych genov v roznych tkanivach a podobne v UCSC genome browseri

• Chodte na stranku http://genome.ucsc.edu/, najdite PTPRZ1 gen v ludskom genome
• Zvolte Tools->Gene Sorter, sort by nechajme Expression (GNF Atlas 2), search PTPRZ1
  • Dostane tabulku genov s podobny profilom expresie ako PTPRZ1 (červená je vysoká expresia, zelená nízka)

• Chceme zistiť, či v tomto zozname je nadreprezentovaná nejaká funkčná kategória
  • Potrebujeme najskôr získať zoznam genov bez dalsich udajov
  • Stlacte configure, tlacidlom hide all zrusite vsetky zaskrtnute typy informacie a zakrtnite iba Name, stlačíte submit
  • Potom stlačte tlačidlo text a dostanete čisto zoznam mien génov v textovom formáte
  • V prípade problémov ho nájdete ho aj tu
• http://biit.cs.ut.ee/gprofiler/ mena genov skopirujme do policka Query, stlacte g:Profile!
  • Vo vyslednej tabulke je kazdy riadok jedna funkcna kategoria, v ktorej su geny s tymto profilom expresie nadreprezentovane, kazdy stlpec jeden gen. Mena kategorii su uplne vpravo.
• Co by sme na zaklade nadreprezentovanych kategorii usudzovali o tomto gene?
• Najdite tento gen v Uniprote (http://www.uniprot.org/), potvrdzuje nase domnienky?

• Vratme sa do genome browsera, najdime si PTPRZ1 gen v genome
• V browseri su rozne tracky tykajuce sa expresie, napr. GNF Atlas 2. Precitajte si, co je v tomto tracku zobrazene, zapnite si ho a pozrite si expresiu okolitych genov okolo PTPRZ1
• Kliknite na gen v tracku UCSC known genes. V tabulke uvidite zase prehlad expresie v roznych tkanivach (podla GNF Atlasu), linku na Visigene.

NCBI Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/

• Databaza gene expression dat na NCBI
• Do okienka Data sets zadajme GDS2925
• Mali by sme dostat Various weak organic acids effect on anaerobic yeast chemostat cultures
• Mozeme si pozriet zakladne udaje, napr. citation, platform
• Link "Expression profiles" nam zobrazi grafy pre rozne geny
• Pri kazdom profile mozeme kliknut na profile neighbors, aby sme videli geny s podobnym profilom
• Data analysis tools, cast Cluster heatmaps, K-means, skuste rozne pocty clustrov

Sekvenčné motívy, program MEME

• Vazobne miesta transkripcnych faktorov sa casto reprezentuju ako sekvencne motivy
• Ak mame skupinu sekvencii, mozeme hladat motiv, ktory maju spolocny
• Znamy program na tento problem je MEME
• Chodte na stranku http://meme.nbcr.net/
• Zvolte nastroj MEME a do okienka "actual sequences" zadajte tieto sekvencie
• Pozrite si ostatne nastavenia. Co asi robia?
• Ak server pocita dlho, mozete si pozriet vysledky tu

Uniprot

• Prehladnejsi pohlad na proteiny, vela linkov na ine databazy, cast vytvarana rucne
  • Pozrieme sa na enzým Bis(5'-adenosyl)-triphosphatase
  • Nájdime ho na stránke http://www.uniprot.org/ pod názvom FHIT_HUMAN
  • Pozrime si podrobne jeho stránku, ktoré časti boli predpovedané bioinformatickými metódami z prednášky?
  • Všimnime si Pfam doménu a pozrime si jej stránku, do akej super-rodiny (klanu) patrí?

Geny

• Zvolte starsiu verziu ludskeho genomu hg18, ktora ma viac informacii
• Do okienka position zadajte gen MAGEA2B a potom zvolte jeden jeho vyskyt (ma dva vyskyty)
  • Dostanete sa tam aj touto linkou: [5]
• Ak date 3x zoom out, mozete si vsimnut, ze tento gen ma viacero foriem zostrihu, ktore sa ale lisia iba v 5' UTR
• Vela veci sa mozete dozvediet klikanim na rozne casti broswera: napr, kliknutim na gen si mozete precitat o jeho funkcii, kliknutim na listu ku tracku (lavy okraj obazku) sa dozviete viac o tracku a mozete nastavovat parametre zobrazenia

Summerschool 2011

Pfam domain database

Pfam database http://pfam.sanger.ac.uk/ contains profile HMMs of protein domain families. Use Sequence search at this webpage to find which domains are in our protein.

Then study in more detail zf-C4 domain which should be among the results. In Summary tab we can see description of the domain as well as Gene ontology (GO) terms. In HMM logo tab we can see the graphical representation of the HMM for this family. Which amino acid is most frequent at positions 3 and 6 of this domain?

PDB dababase for protein structures

Use Sequence search at http://www.rcsb.org/ to find the closest homolog with known structure. You see an overview of the structure, download the file with coordinates, but also can find e.g. the paper where the structure was published and secondary structure (alpha helices, beta sheets).

Uniprot database of proteins

Uniprot http://www.uniprot.org/ organizes known information about function, structure and other aspects of individual proteins from all organisms. Use BLAST at this webpage to find which protein was used in this excercise (it should have 100% sequence identity in BLAST results). Which protein it comes from and what is its name? Proteins denoted by golden star in BLAST results have detailed information available. Which is the closest homolog with the star?