1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2022/23

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Quizzes can be found in Moodle.
Homework assignments and journal club papers can be found in Tasks and dates.
Groups for journal club have each their own channel in MS Teams.


CB10

Z MBI
Prejsť na: navigácia, hľadanie

RNA štruktúra

  • Znama databaza rodin RNA genov je Rfam: http://rfam.xfam.org/
  • Najdite si v nej rodinu RF00015 (U4 spliceosomal RNA)
  • V casti Secondary structure si mozete pozriet obrazky farebne kodovane podla roznych kriterii
    • Skuste pochopit, co jednotlive obrazky a ich farby znamenaju
  • Jedna z mnohych ludskych kopii je tato:
AGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCG
ATTATTGCTAATTGAAAACTTTTCCCAATACCCCGCCATGACGACTTGAA
ATATAGTCGGCATTGGCAATTTTTGACAGTCTCTACGGAGA
  • Skuste ju najst v ludskom genome nastrojom BLAT v UCSC genome browseri
  • Pozrite si tracky GENCODE genes, conservation, RepeatMasker v jej okoli
  • Vo verzii hg19 (kam sa viete z inej verzii dostat cez horne menu View->In Other Genomes) je track "CSHL Sm RNA-seq" ktory obsahuje RNASeq kratkych RNA z roznych casti buniek, zapnite si v jeho nastaveniach aj zobrazenie RNA z jadra (nucleus)
  • Zadajte sekvenciu na RNAfold serveri [1]
  • Ak vypocet dlho trva, pozrite si vysledok tu
  • Podoba sa na strukturu zobrazenu v Rfame? v com sa lisi?

PSI BLAST

  • Toto cvičenie je z časti inšpirované stránkou [2]
  • Budeme uvažovať vzdialene podobné enzýmy
    • Bis(5'-adenosyl)-triphosphatase (Uniprot)
    • Galactose-1-phosphate uridylyltransferase (GALT/GAL7) (Uniprot)
    • Ich domény patria v databáze Pfam do toho istého klanu
  • Skúsme nájsť túto podobnosť v BLASTe: http://blast.ncbi.nlm.nih.gov/ v časti proteíny, zvoľme databázu Swissport, ako Query zadajme Accesion nášho proteínu P49789, spustime program PSI-BLAST
  • V prvom kole PSI-BLAST spúšťa bežný BLASTP
  • GAL gén (konkrétne GAL7_HAEIN, accession P31764) sa nachádza medzi výsledkami, ale má príliš vysokú E-value
  • Spustíme teraz druhú iteráciu PSI-BLAST, ktorá zostaví profil z proteínov s nízkou E-value v prvej iterácii
  • Aká je E-value nájdeného zarovnania?
  • Ak by výpočet dlho trval, výsledky sú tu: 1. kolo, 2. kolo

Nadreprezentácia, Uniprot (cvičenie pri počítači)

Data o expresii ludskych genov v roznych tkanivach a podobne v UCSC genome browseri

  • Chodte na genome browser http://genome-euro.ucsc.edu/
  • Zvolte Tools->Gene Sorter, sort by nechajme Expression (GTEx), a do okienka search zadajme identifikator genu PTPRZ1
    • Dostane tabulku genov s podobnym profilom expresie ako PTPRZ1 (červená je vysoká expresia, zelená nízka)
    • Zoznam tychto genov v textovom formate najdete tu
  • http://biit.cs.ut.ee/gprofiler/ mena genov skopirujme do policka Query, stlacte g:Profile!
    • Ak by výpočet dlho trval, nájdete ho aj tu
    • Vo výslednej tabuľke je každý riadok jedna funkcna kategoria, v ktorej su geny s tymto profilom expresie nadreprezentovane, kazdy stlpec jeden gen.
    • V spodnej casti tabuly su aj asociacie k chorobam a k transkripcnym faktorom, ktore by mohli prislusne geny regulovat
  • Co by sme na zaklade nadreprezentovanych kategorii usudzovali o gene PTPRZ1?
  • Najdite tento gen v Uniprote (http://www.uniprot.org/), potvrdzuje nase domnienky?
    • O mnohých údajoch na stránke sme sa rozprávali na prednáške (GO kategórie, domény, sekundárna a 3D štruktúra)
    • na veľa miestach na stránke je uvedené aj odkiaľ jednotlivé údaje pochádzajú
    • Všimnime si Pfam domény a pozrime si ich stránku
  • Vratme sa do genome browsera, najdime si PTPRZ1 gen v genome [3]
  • V browseri su rozne tracky tykajuce sa expresie, napr. GTEx. Precitajte si, co je v tomto tracku zobrazene, zapnite si ho a pozrite si expresiu okolitych genov okolo PTPRZ1
  • Kliknite na gen v tracku UCSC known genes. V tabulke uvidite zase prehlad expresie v roznych tkanivach (podla GTEx)


Objavenie génu HAR1 pomocou komparatívnej genomiky

  • Pollard KS, Salama SR, Lambert N, et al. (September 2006). "An RNA gene expressed during cortical development evolved rapidly in humans". Nature 443 (7108): 167–72. doi:10.1038/nature05113. PMID 16915236. pdf
  • Zobrali všetky regióny dĺžky aspoň 100bp s > 96% podobnosťou medzi šimpanzom a myšou/potkanom (35,000)
  • Porovnali s ostatnými cicavcami, zistili, ktoré majú veľa mutáci v človeku, ale málo inde (pravdepodobnostný model)
  • 49 štatisticky významných regiónov, 96% nekódujúcich oblastiach
  • Najvýznamnejší HAR1: 118nt, 18 substitúcii u človeka, očakávali by sme 0.27. Iba 2 zmeny medzi šimpanzom a sliepkou (310 miliónov rokov), ale nebol nájdený v rybách a žabe.
  • Nezdá sa byť polymorfný u človeka
  • Prekrývajúce sa RNA gény HAR1A a HAR1B
  • HAR1A je exprimovaný v neokortexe u 7 a 9 týždenných embrií, neskôr aj v iných častiach mozgu (u človeka aj iných primátov)
  • Všetky substitúcie v človeku A/T->C/G, stabilnejšia RNA štruktúra (ale tiež sú blízko k telomére, kde je viacej takýchto mutácii kvôli rekombinácii a biased gene conversion)

Cvičenie pri počítači

  • Môžete si pozrieť tento region v browseri: chr20:63102114-63102274 (hg38), pricom ak sa este priblizite, uvidite zarovnanie aj s bazami a mozete vidiet, ze vela zmien je specifickych pre cloveka

Expresia génov

NCBI Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/

  • Databaza gene expression dat na NCBI
  • Do Search okienka zadajme GDS2925
  • Mali by sme dostat dataset Various weak organic acids effect on anaerobic yeast chemostat cultures
  • Mozeme si pozriet zakladne udaje, napr. citation, platform
  • Link "Expression profiles" nam zobrazi grafy pre rozne geny
  • Pri kazdom profile mozeme kliknut na profile neighbors, aby sme videli geny s podobnym profilom
  • Data analysis tools, cast Cluster heatmaps, K-means, skuste rozne pocty clustrov
    • napr. K=4 a K=5 pre Pearsonovu korelaciu
    • mozeme is pozriet aj hierarchicke zhlukovanie

Sekvenčné motívy, program MEME

  • Vazobne miesta transkripcnych faktorov sa casto reprezentuju ako sekvencne motivy
  • Ak mame skupinu sekvencii, mozeme hladat motiv, ktory maju spolocny
  • Znamy program na tento problem je MEME
  • Chodte na stranku http://meme-suite.org/
  • Zvolte nastroj MEME a v casti Input the primary sequences zvolte Type in sequences a zadajte tieto sekvencie
  • Pozrite si ostatne nastavenia. Co asi robia?
  • Ak server pocita dlho, mozete si pozriet vysledky tu

Kvasinkové transkripčné faktory v SGD

  • Yeast genome database SGD obsahuje pomerne podrobne stranky pre jednotlive transkripcne faktory
  • Pozrime si stranku pre transkripcny faktor GAL4 [4]

Uniprot

  • Prehladnejsi pohlad na proteiny, vela linkov na ine databazy, cast vytvarana rucne
    • Pozrieme sa na známy koronavírusový proteín Spike
    • Nájdime ho na stránke http://www.uniprot.org/ pod názvom SPIKE_SARS2
    • Pozrime si podrobne jeho stránku, ktoré časti boli predpovedané bioinformatickými metódami z prednášky?
    • Všimnime si niektorú Pfam doménu a pozrime si jej stránku

Nussinovovej algoritmus (nerobili sme)

Z cvičných príkladov na skúšku

  • Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
 G A A C U U C A C U G A
 0 0 0 1 1 2 3 3 3 4 4 4  G
   0 0 0 1 2 2 2 2 3 4 4  A
     0 0 1 1 1 2 2 2 3 4  A
       0 0 0 0 1 1 1 2 3  C
         0 0 0 1 1 1 2 3  U
           0 0 1 1 1 2 3  U
             0 0 0 1 2 2  C
               0 0 1 1 1  A
                 0 0 1 1  C
                   0 0 1  U
                     0 0  G
                       0  A
  • Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?