1-BIN-301, 2-AIN-501 Metódy v bioinformatike, ZS 2018/19

Úvod · Pravidlá · Termíny a zadania · Prednášky a poznámky · Facebook (oznamy a diskusie) (návod a pravidlá)
Zadania domácich úloh a články na journal club nájdete v časti Termíny a zadania.
Pozrite si ukážkové príklady na skúšku.
Rozpis skupín pre journal club je zverejnený.


CI10

Z MBI
Prejsť na: navigácia, hľadanie

Úvod do bioinformatických databáz a on-line nástrojov

NCBI, Genbank, Pubmed, blast

  • National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/
  • Zhromazduje verejne pristupne data z molekularnej biologie
  • Mozeme hladat klucove slova v roznych databazach
    • Pubmed: databaza clankov, napr. najdime phastcons
    • Gene: najdime DNA polymerase
    • BLAST: najdime nasledujucu sekvenciu v genome kurata (zvoľme nucleotide blast, database others a z menu reference genomic sequence, organism chicken (taxid:9031), program blastn)
    • Ide o osekvenovany kusok ludskej mRNA, kde v kuracom genome sme nasli homolog, ake ma dlzku, skore, E-value, % zhodnych baz?
AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA
AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC
GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA
CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC
CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC
AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA
GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG
TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC
TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC
ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG
GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC
CCGAAAAGCCCCCACAAAAAGCCG

Uniprot

  • Prehladnejsi pohlad na proteiny, vela linkov na ine databazy, cast vytvarana rucne
    • Pozrieme sa na enzým Bis(5'-adenosyl)-triphosphatase
    • Nájdime ho na stránke http://www.uniprot.org/ pod názvom FHIT_HUMAN
    • Pozrime si podrobne jeho stránku, ktoré časti boli predpovedané bioinformatickými metódami z prednášky?
    • Všimnime si Pfam doménu a pozrime si jej stránku

UCSC genome browser

  • http://genome.ucsc.edu/
  • On-line grafický nástroj na prezeranie genómov
  • Konfigurovateľný, veľa možností, prijemne pouzivatelske rozhranie
  • Moznost stiahnut data vhodne na dalsie spracovanie alebo zobrazit vlastne data
  • Pomerne málo organizmov
    • doraz hlavne na ludsky genom

Základy

  • Adresa http://genome.ucsc.edu/
  • Hore v modrom menu zvoľte Genomes, potom zvoľte ľudský genóm. Do okienka search term zadajte HOXA2. Vo výsledkoch hľadania (UCSC genes) zvoľte gén homeobox A2 na chromozóme 7.
    • Pozrime si spolu túto stránku
    • V hornej časti sú ovládacie prvky na pohyb vľavo, vpravo, približovanie, vzďaľovanie
    • Pod tým schéma chromozómu, červeným vyznačená zobrazená oblasť
    • Pod tým obrázok vybranej oblasti, rôzne tracky
    • Pod tým zoznam všetkých trackov, dajú sa zapínať, vypínať a konfigurovať
    • Po kliknutí na obrázok sa často zobrazí ďalšia informácia o danom géne alebo inom zdroji dát
    • V génoch exony hrubé, UTR tenšie, intróny vodorovné čiary
  • Po kliknutí na gén alebo inú časť nejakého tracku väčšinou o ňom dostaneme viac informácií. Kliknutim na listu ku tracku (lavy okraj obazku) sa dozviete viac o tracku a mozete nastavovat parametre zobrazenia

Sekvenovanie

  • Hore v modrom menu zvoľte Genomes
  • Na ďalšej stránke zvoľte človeka a v menu Assembly zistite, kedy boli pridané posledné dve verzie ľudského genómu (hg19 a hg38)
  • Na tej istej stránke dole nájdete stručný popis zvolenej verzie genómu. Pre ktoré oblasti genómu máme v hg38 najviac alternatívnych verzií?
  • Zadajte región chr21:31,250,000-31,300,000 v hg19 [1]
  • Zapnite si tracky Mapability a RepeatMasker na "full"
  • Mapability: nakoľko sa daný úsek opakuje v genóme a či teda vieme jednoznačne jeho ready namapovať pri použití Next generation sequencing
  • Ako a prečo sa pri rôznych dĺžkach readov líšia? (Keď kliknete na linku "Mapability", môžete si prečítať bližšie detaily.)
  • Približne v strede zobrazeného regiónu je pokles mapovateľnosti. Akému typu opakovania zodpovedá? (pozrite track RepeatMasker)
  • Zapnite si tracky "Assembly" a "Gaps" a pozrite si región chr2:110,000,000-110,300,000 v hg19. [2] Aká dlhá je neosekvenovaná medzera (gap) v strede tohto regiónu? Približnú veľkosť môžete odčítať z obrázku, presnejší údaj zistíte kliknutím na čierny obdĺžnik zodpovedajúci tejto medzere (úplne presná dĺžka aj tak nebola známa, nakoľko nebola osekvenovaná).
  • Cez menu položku View, In other genomes si pozrite, ako zobrazený úsek vyzerá vo verzii hg38. Ako sa zmenila dĺžka z pôvodných 300kb?
  • Prejdite na genóm Rhesus, verzia rheMac2, región chr7:59,022,000-59,024,000 [3], zapnite si tracky Contigs, Gaps, Quality scores
  • Aké typy problémov v kvalite sekvencie v tomto regióne vidíte?

Komparativna genomika

  • V casti multiz alignments vidite zarovnania k roznym inym genomom (da sa zapinat, ze ku ktorym). Mozete si pozriet, ako sa uroven zarovnania zmeni ked sa priblizujeme a vzdalujeme (zoom in/zoom out).
  • Ked sa priblizite na uroven "base", t.j. zobrazenych cca 100bp, v obdlzniku multiz alignment uvidite zarovnanie s homologickym usekom v inych genomoch.
  • V casti conservation by PhyloP vidime graf toho, ako silne su zachovane jednotlive stlpce zarovnania
  • Da sa zapnut track Placental Chain/Net a pozriet sa na ktorych chromozomoch je ortologicky usek v inych genomoch

Blat

  • Choďte na UCSC genome browser (http//genome.ucsc.edu/), na modrej lište zvoľte BLAT, zadajte DNA sekvenciu vyssie a hľadajte ju v ľudskom genóme. Akú podobnosť (IDENTITY) má najsilnejší nájdený výskyt? Aký dlhý úsek genómu zasahuje? (SPAN). Všimnite si, že ostatné výskyty sú oveľa kratšie.
  • V stĺpci ACTIONS si pomocou Details môžete pozrieť detaily zarovnania a pomocou Browser si pozrieť príslušný úsek genómu.
  • V tomto úseku genómu si zapnite track Vertebrate net na full a kliknutím na farebnú čiaru na obrázku pre tento track zistite, na ktorom chromozóme kuraťa sa vyskytuje homologický úsek.
  • Skusme tu istu sekvenciu namapovat do genomu sliepky: stlacte najprv na hornej modrej liste Genomes, zvolte Vertebrates a Chicken a potom na hornej liste BLAT. Do okienka zadajte tu istu sekvenciu. Akú podobnosť a dĺžku má najsilnejší nájdený výskyt teraz? Na ktorom je chromozóme?
  • Ako sa to porovna s hodnotami, ktore sme dostali pomocou BLASTu na NCBI?

Práca s tabuľkami, sťahovanie anotácií

  • Položka Tables na hornej lište umožnuje robiť rafinované veci s tabuľkami, ktoré obsahujú súradnice génov a pod.
  • Základná vec: vyexportovať napr. všetky gény v zobrazenom výseku v niektorom formáte:
    • sequence: fasta súbor proteínov, génov alebo mRNA s rôznymi nastaveniami
    • GTF: súradnice
    • Hyperlinks to genome browser: klikacia stránka
  • Namiesto exportu si môžeme pozrieť rôzne štatistiky
  • Zložitejšie: prienik dvoch tabuliek, napr. gény, ktoré sú viac než 50% pokryté simple repeats
    • V intersection zvolíme group: Variation and repeats, track: RepeatMasker, nastavíme records that have at least 50% overlap with RepeatMasker
    • V summary/statistics zistíme, kolko ich je v genóme, môžeme si ich preklikať cez Hyperlinks to genome browser
  • Filter na tabuľku, napr. gény, ktoré majú v názve ribosomal (postup pre drozofilu):
    • V casti hg19.kgXref based filters políčko description dáme *ribosomal*

Úvod do bezkontextových gramatík

  • Na modelovanie štruktúry RNA sa používajú stochastické bezkontextové gramatiky (bude na ďalšej prednáške)
  • Tie sú založené na [bezkontextových gramatikách, ktoré mnohí poznáte z bakalárskeho štúdia

Gramatika

  • Príklad: S->aSb, S->epsilon (píšeme aj skrátene S->aSb|epsilon)
  • Dva typy symbolov: terminály (malé písmená), neterminály (veľké písmená)
  • Pravidlá prepisujúce neterminál na reťazec terminálov a neterminálov (môže byť aj prázdny reťazec, ktorý označujeme epsilon)
  • Neterminál S je "štartovací"

Použitie gramatiky na generovanie reťazcov

  • Začneme so štartovacím neterminálom S
  • V každom kroku prepíšeme najľavejší neterminál podľa niektorého pravidla
  • Skončíme, keď nezostanú žiadne neterminály
  • Príklad: S->aSb->aaSbb->aaaSbbb->epsilon
  • Aké všetky slová vie táto gramatika generovať?
    • V tvare aa...abb...b s rovnakým počtom á-čok a b-čiek (informatici píšu a^{k}b^{k})

Cvičenia

  • Zostavte gramatiku na slova typu aa..abb..b kde acok je rovnako alebo viac ako bcok, a^{i}b^{j} pre i\geq j
    • S->aSb|aS|epsilon
  • Zostavte gramatiku pre slova toho isteho typu, kde acok je viac ako bcok, t.j. i>j
    • S->aSb|aT T->aT|epsilon (alebo S->aSb|aS|a)
  • Zostavte gramatiku pre dobre uzatvorkovane vyrazy zo zatvoriek (,),[,]. Napr. [()()([])] je dobre uzatvorkovany, ale [(]) nie je.
    • S->SS|(S)|[S]|epsilon
    • priklad odvedenia v tejto gramatike: S->[S]->[SS]->[SSS]->[(S)SS]->[()SS]->[()(S)S]->[()()S]->[()()(S)]->[()()([S])]->[()()([])]

Parsovanie retazca pomocou gramatiky: urcit, ako mohol byt retazec vygenerovany pomocou pravidiel

  • Gramatika pre dobre uzatvrokovane vyrazy nam pomoze urcit, ktora zatvorka patri ku ktorej: tie, ktore boli vygenerovane v jednom kroku

Dalsie cvicenia

  • Zostavte gramatiku na DNA palindromy, t.j. sekvencie, ktore zozadu po skomplementovani baz daju to iste, ako napr. GATC
    • S->gSc|cSg|aSt|tSa|epsilon
  • Vlasenky RNA s lubovolne dlhou sparovanou castou a 3 nesparovanymi nukleotidmi v strede
    • S->gSc|cSg|aSu|uSa|aaa|aac|aag|aau|...|uuu
  • Tazsi priklad: Zostavte gramatiku na slova s rovnakym poctom acok a bcok v lubovolnom poradi
    • S->epsilon|aSbS|bSaS
    • ako bude generovat aababbba?
    • preco vie vygenerovat vsetky take retazce?