1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2022/23

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Quizzes can be found in Moodle.
Homework assignments and journal club papers can be found in Tasks and dates.
Groups for journal club have each their own channel in MS Teams.


CB10: Rozdiel medzi revíziami

Z MBI
Prejsť na: navigácia, hľadanie
(Vytvorená stránka „==Nussinovovej algoritmus== Z cvičných príkladov na skúšku * Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho poč...“)
 
Riadok 3: Riadok 3:
 
Z cvičných príkladov na skúšku
 
Z cvičných príkladov na skúšku
 
* Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
 
* Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
 +
<!--
 
<pre>
 
<pre>
 
  G A A C U U C A C U G A
 
  G A A C U U C A C U G A
Riadok 18: Riadok 19:
 
                       0  A
 
                       0  A
 
</pre>
 
</pre>
 +
-->
  
 
* Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?
 
* Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?

Verzia zo dňa a času 16:49, 26. november 2020

Nussinovovej algoritmus

Z cvičných príkladov na skúšku

  • Vyplňte maticu dynamického programovania (Nussinovovej algoritmus) pre nájdenie najväčšieho počtu dobre uzátvorkovaných spárovaných báz v RNA sekvencii GAACUUCACUGA (dovoľujeme len komplementárne páry A-U, C-G) a nakreslite sekundárnu štruktúru, ktorú algoritmus našiel.
  • Ako by sme algoritmus upravili, aby dlzka slucky na konci helixu bola vzdy aspon 3?

RNA štruktúra

  • Znama databaza rodin RNA genov je Rfam: http://rfam.xfam.org/
  • Najdite si v nej rodinu RF00015 (U4 spliceosomal RNA)
  • V casti Secondary structure si mozete pozriet obrazky farebne kodovane podla roznych kriterii
    • Skuste pochopit, co jednotlive obrazky a ich farby znamenaju
  • Jedna z mnohych ludskych kopii je tato:
AGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCG
ATTATTGCTAATTGAAAACTTTTCCCAATACCCCGCCATGACGACTTGAA
ATATAGTCGGCATTGGCAATTTTTGACAGTCTCTACGGAGA
  • Skuste ju najst v ludskom genome nastrojom BLAT v UCSC genome browseri
  • Pozrite si tracky GENCODE genes, conservation, RepeatMasker v jej okoli
  • Vo verzii hg19 (kam sa viete z inej verzii dostat cez horne menu View->In Other Genomes) je track "CSHL Sm RNA-seq" ktory obsahuje RNASeq kratkych RNA z roznych casti buniek, zapnite si v jeho nastaveniach aj zobrazenie RNA z jadra (nucleus)
  • Zadajte sekvenciu na RNAfold serveri [1]
  • Ak vypocet dlho trva, pozrite si vysledok tu
  • Podoba sa na strukturu zobrazenu v Rfame? v com sa lisi?