Lbioinf3

HWbioinf3

Polymorphisms

• Individuals within species differ slightly in their genomes
• Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%)
• SNP: single-nucleotide polymorphism (a polymorphism which is a substitution of a single nucletide)
• Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father
• At a particular location, a single human can thus have two different alleles (heterozygosity) or two copies of the same allele (homozygosity)

Finding polymorphisms / genome variants

• We compare sequencing reads coming from an individual to a reference genome of the species
• First we align them, as in the exercises on genome assembly
• Then we look for positions where a substantial fraction of reads does not agree with the reference (this process is called variant calling)

Programs and file formats

• For mapping, we will use BWA-MEM (you can also try Minimap2, as in the exercises on genome assembly)
• For variant calling, we will use Freebayes
• For reads and read alignments, we will use FASTQ and BAM files, as in the previous lectures
• For storing found variants, we will use VCF files
• For storing genome intervals, we will use BED files

Human variants

• For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world
• There are various databases, e.g. dbSNP, OMIM, or user-editable SNPedia

UCSC genome browser

• On-line tool similar to IGV
• http://genome-euro.ucsc.edu/
• Nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented

Basics

• On the front page, choose Genomes in the top blue menu bar
• Select a genome and its version, optionally enter position or keyword, press submit
• On the browser screen top image shows chromosome map, selected region in red
• Below a view of the selected region and various track with information about this region
• For example some of the top tracks display genes (boxes are exons, lines are introns)
• Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space)
• Buttons for navigation are at the top (move, zoom, etc.)
• Clicking at the browser figure allows you to get more information about a gene or other displayed item
• In this lecture, we will need tracks GENCODE and dbSNP - check e.g. gene ACTN3 and within it SNP rs1815739 in exon 15

Blat

• For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species)
• Choose Tools->Blat in the top blue menu bar, enter DNA sequence below, search in the human genome
  • What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter)
  • Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region

AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA
AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC
GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA
CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC
CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC
AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA
GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG
TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC
TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC
ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG
GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC
CCGAAAAGCCCCCACAAAAAGCCG