1-DAV-202 Data Management 2023/24
Previously 2-INF-185 Data Source Integration
Difference between revisions of "Lbioinf3"
Jump to navigation
Jump to search
| (2 intermediate revisions by the same user not shown) | |||
| Line 4: | Line 4: | ||
==Polymorphisms== | ==Polymorphisms== | ||
| − | * Individuals within species differ slightly in their genomes | + | * Individuals within species differ slightly in their genomes. |
| − | * Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%) | + | * Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%). |
| − | * | + | * SNP: single-nucleotide polymorphism (a polymorphism which is a substitution of a single nucleotide). |
| − | * Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father | + | * Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father. |
| − | * At a particular location, a single human can thus have two different alleles ( | + | * At a particular chromosomal location, a single human can thus have two different alleles (heterozygot) or two copies of the same allele (homozygot). |
==Finding polymorphisms / genome variants== | ==Finding polymorphisms / genome variants== | ||
| − | * We compare sequencing reads coming from an individual to a reference genome of the species | + | * We compare sequencing reads coming from an individual to a reference genome of the species. |
| − | * First we align them, as in [[HWbioinf1|the exercises on genome assembly]] | + | * First we align them, as in [[HWbioinf1|the exercises on genome assembly]]. |
| − | * Then we look for positions where a substantial fraction of reads does not agree with the reference (this process is called variant calling) | + | * Then we look for positions where a substantial fraction of the reads does not agree with the reference (this process is called variant calling). |
==Programs and file formats== | ==Programs and file formats== | ||
| − | * For mapping, we will use <tt>[https://github.com/lh3/bwa BWA-MEM]</tt> (you can also try Minimap2, as in [[HWbioinf1|the exercises on genome assembly]]) | + | * For mapping, we will use <tt>[https://github.com/lh3/bwa BWA-MEM]</tt> (you can also try Minimap2, as in [[HWbioinf1|the exercises on genome assembly]]). |
| − | * For variant calling, we will use [https://github.com/ekg/freebayes FreeBayes] | + | * For variant calling, we will use [https://github.com/ekg/freebayes FreeBayes]. |
| − | * For reads and read alignments, we will use FASTQ and BAM files, as in the [[Lbioinf1|previous lectures]] | + | * For reads and read alignments, we will use FASTQ and BAM files, as in the [[Lbioinf1|previous lectures]]. |
| − | * For storing found variants, we will use [http://www.internationalgenome.org/wiki/Analysis/vcf4.0/ VCF files] | + | * For storing found variants, we will use [http://www.internationalgenome.org/wiki/Analysis/vcf4.0/ VCF files]. |
| − | * For storing genome intervals, we will use [https://genome.ucsc.edu/FAQ/FAQformat.html#format1 BED files] | + | * For storing genome intervals, we will use [https://genome.ucsc.edu/FAQ/FAQformat.html#format1 BED files] as in the [[Lbioinf2|previous lecture]]. |
==Human variants== | ==Human variants== | ||
| − | * For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world | + | * For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world. |
| − | * There are various databases, e.g. [https://www.ncbi.nlm.nih.gov/SNP/ dbSNP], [https://www.omim.org/ OMIM], or user-editable [https://www.snpedia.com/index.php/SNPedia SNPedia] | + | * There are various databases, e.g. [https://www.ncbi.nlm.nih.gov/SNP/ dbSNP], [https://www.omim.org/ OMIM], or user-editable [https://www.snpedia.com/index.php/SNPedia SNPedia]. |
==UCSC genome browser== | ==UCSC genome browser== | ||
| Line 30: | Line 30: | ||
A short video for this section: [https://youtu.be/RwEBS62Avaw] | A short video for this section: [https://youtu.be/RwEBS62Avaw] | ||
<!-- /NOTEX --> | <!-- /NOTEX --> | ||
| − | * | + | * The [http://genome-euro.ucsc.edu/ UCSC genome browser] is an on-line tool similar to IGV. |
| − | + | * It has nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented. | |
| − | * | ||
====Basics==== | ====Basics==== | ||
| − | * On the front page, choose Genomes in the top blue menu bar | + | * On the front page, choose Genomes in the top blue menu bar. |
| − | * Select a genome and its version, optionally enter a position or a keyword, press submit | + | * Select a genome and its version, optionally enter a position or a keyword, press submit. |
| − | * On the browser screen, the top image shows chromosome map, the selected region is in red | + | * On the browser screen, the top image shows chromosome map, the selected region is in red. |
| − | * Below there is a view of the selected region and various tracks with information about this region | + | * Below there is a view of the selected region and various tracks with information about this region. |
| − | * For example some of the top tracks display genes (boxes are exons, lines are introns) | + | * For example some of the top tracks display genes (boxes are exons, lines are introns). |
| − | * Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space) | + | * Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space). |
| − | * Buttons for navigation are at the top (move, zoom, etc.) | + | * Buttons for navigation are at the top (move, zoom, etc.). |
| − | * Clicking at the browser figure allows you to get more information about a gene or other displayed item | + | * Clicking at the browser figure allows you to get more information about a gene or other displayed item. |
| − | * In this lecture, we will need tracks GENCODE and dbSNP - check e.g. [http://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&position=chr11%3A66546841-66563329 gene ACTN3] and within it SNP <tt>rs1815739</tt> in exon 15 | + | * In this lecture, we will need tracks GENCODE and dbSNP - check e.g. [http://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&position=chr11%3A66546841-66563329 gene ACTN3] and within it SNP <tt>rs1815739</tt> in exon 15. |
====Blat==== | ====Blat==== | ||
| − | * For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species) | + | * For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species). |
| − | * Choose <tt>Tools->Blat</tt> in the top blue menu bar, enter DNA sequence below, search in the human genome | + | * Choose <tt>Tools->Blat</tt> in the top blue menu bar, enter DNA sequence below, search in the human genome. |
| − | ** What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter) | + | ** What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter). |
| − | ** Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region | + | ** Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region. |
<pre> | <pre> | ||
AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC | AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC | ||
Latest revision as of 19:14, 10 April 2024
Contents
Polymorphisms
- Individuals within species differ slightly in their genomes.
- Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%).
- SNP: single-nucleotide polymorphism (a polymorphism which is a substitution of a single nucleotide).
- Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father.
- At a particular chromosomal location, a single human can thus have two different alleles (heterozygot) or two copies of the same allele (homozygot).
Finding polymorphisms / genome variants
- We compare sequencing reads coming from an individual to a reference genome of the species.
- First we align them, as in the exercises on genome assembly.
- Then we look for positions where a substantial fraction of the reads does not agree with the reference (this process is called variant calling).
Programs and file formats
- For mapping, we will use BWA-MEM (you can also try Minimap2, as in the exercises on genome assembly).
- For variant calling, we will use FreeBayes.
- For reads and read alignments, we will use FASTQ and BAM files, as in the previous lectures.
- For storing found variants, we will use VCF files.
- For storing genome intervals, we will use BED files as in the previous lecture.
Human variants
- For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world.
- There are various databases, e.g. dbSNP, OMIM, or user-editable SNPedia.
UCSC genome browser
A short video for this section: [1]
- The UCSC genome browser is an on-line tool similar to IGV.
- It has nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented.
Basics
- On the front page, choose Genomes in the top blue menu bar.
- Select a genome and its version, optionally enter a position or a keyword, press submit.
- On the browser screen, the top image shows chromosome map, the selected region is in red.
- Below there is a view of the selected region and various tracks with information about this region.
- For example some of the top tracks display genes (boxes are exons, lines are introns).
- Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space).
- Buttons for navigation are at the top (move, zoom, etc.).
- Clicking at the browser figure allows you to get more information about a gene or other displayed item.
- In this lecture, we will need tracks GENCODE and dbSNP - check e.g. gene ACTN3 and within it SNP rs1815739 in exon 15.
Blat
- For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species).
- Choose Tools->Blat in the top blue menu bar, enter DNA sequence below, search in the human genome.
- What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter).
- Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region.
AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC CCGAAAAGCCCCCACAAAAAGCCG
