1-DAV-202 Data Management 2024/25
Lbioinf3
Jump to navigation
Jump to search
Contents
Polymorphisms
- Individuals within species differ slightly in their genomes.
- Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%).
- SNP: single-nucleotide polymorphism (a polymorphism which is a substitution of a single nucleotide).
- Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father.
- At a particular location, a single human can thus have two different alleles (heterozygosity) or two copies of the same allele (homozygosity).
Finding polymorphisms / genome variants
- We compare sequencing reads coming from an individual to a reference genome of the species.
- First we align them, as in the exercises on genome assembly.
- Then we look for positions where a substantial fraction of the reads does not agree with the reference (this process is called variant calling).
Programs and file formats
- For mapping, we will use BWA-MEM (you can also try Minimap2, as in the exercises on genome assembly).
- For variant calling, we will use FreeBayes.
- For reads and read alignments, we will use FASTQ and BAM files, as in the previous lectures.
- For storing found variants, we will use VCF files.
- For storing genome intervals, we will use BED files.
Human variants
- For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world.
- There are various databases, e.g. dbSNP, OMIM, or user-editable SNPedia.
UCSC genome browser
A short video for this section: [1]
- The UCSC genome browser is an on-line tool similar to IGV.
- It has nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented.
Basics
- On the front page, choose Genomes in the top blue menu bar.
- Select a genome and its version, optionally enter a position or a keyword, press submit.
- On the browser screen, the top image shows chromosome map, the selected region is in red.
- Below there is a view of the selected region and various tracks with information about this region.
- For example some of the top tracks display genes (boxes are exons, lines are introns).
- Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space).
- Buttons for navigation are at the top (move, zoom, etc.).
- Clicking at the browser figure allows you to get more information about a gene or other displayed item.
- In this lecture, we will need tracks GENCODE and dbSNP - check e.g. gene ACTN3 and within it SNP rs1815739 in exon 15.
Blat
- For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species).
- Choose Tools->Blat in the top blue menu bar, enter DNA sequence below, search in the human genome.
- What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter).
- Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region.
AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC CCGAAAAGCCCCCACAAAAAGCCG