Lbioinf3

HWbioinf3

Polymorphisms

• Individuals within species differ slightly in their genomes.
• Polymorphisms are genome variants which are relatively frequent in a population (e.g. at least 1%).
• SNP: single-nucleotide polymorphism (a polymorphism which is a substitution of a single nucleotide).
• Recall that most human cells are diploid, with one set of chromosomes inherited from the mother and the other from the father.
• At a particular location, a single human can thus have two different alleles (heterozygosity) or two copies of the same allele (homozygosity).

Finding polymorphisms / genome variants

• We compare sequencing reads coming from an individual to a reference genome of the species.
• First we align them, as in the exercises on genome assembly.
• Then we look for positions where a substantial fraction of the reads does not agree with the reference (this process is called variant calling).

Programs and file formats

• For mapping, we will use BWA-MEM (you can also try Minimap2, as in the exercises on genome assembly).
• For variant calling, we will use FreeBayes.
• For reads and read alignments, we will use FASTQ and BAM files, as in the previous lectures.
• For storing found variants, we will use VCF files.
• For storing genome intervals, we will use BED files.

Human variants

• For many human SNPs we already know something about their influence on phenotype and their prevalence in different parts of the world.
• There are various databases, e.g. dbSNP, OMIM, or user-editable SNPedia.

UCSC genome browser

A short video for this section: [1]

• The UCSC genome browser is an on-line tool similar to IGV.
• It has nice interface for browsing genomes, lot of data for some genomes (particularly human), but not all sequenced genomes represented.

Basics

• On the front page, choose Genomes in the top blue menu bar.
• Select a genome and its version, optionally enter a position or a keyword, press submit.
• On the browser screen, the top image shows chromosome map, the selected region is in red.
• Below there is a view of the selected region and various tracks with information about this region.
• For example some of the top tracks display genes (boxes are exons, lines are introns).
• Tracks can be switched on and off and configured in the bottom part of the page (browser supports different display levels, full contains all information but takes a lot of vertical space).
• Buttons for navigation are at the top (move, zoom, etc.).
• Clicking at the browser figure allows you to get more information about a gene or other displayed item.
• In this lecture, we will need tracks GENCODE and dbSNP - check e.g. gene ACTN3 and within it SNP rs1815739 in exon 15.

Blat

• For sequence alignments, UCSC genome browser offers a fast but less sensitive BLAT (good for the same or very closely related species).
• Choose Tools->Blat in the top blue menu bar, enter DNA sequence below, search in the human genome.
  • What is the identity level for the top found match? What is its span in the genome? (Notice that other matches are much shorter).
  • Using Details link in the left column you can see the alignment itself, Browser link takes you to the browser at the matching region.

AACCATGGGTATATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGAC
TGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAA
AGTTGGGCAGGTGTGTTTTTTGTCCTTCAGGTAGCCGAAGAGCATCTCCAGGCCCCCCTCCACCAGCTCC
GGCAGAGGCTTGGATAAAGGGTTGTGGGAAATGTGGAGCCCTTTGTCCATGGGATTCCAGGCGATCCTCA
CCAGTCTACACAGCAGGTGGAGTTCGCTCGGGAGGGTCTGGATGTCATTGTTGTTGAGGTTCAGCAGCTC
CAGGCTGGTGACCAGGCAAAGCGACCTCGGGAAGGAGTGGATGTTGTTGCCCTCTGCGATGAAGATCTGC
AGGCTGGCCAGGTGCTGGATGCTCTCAGCGATGTTTTCCAGGCGATTCGAGCCCACGTGCAAGAAAATCA
GTTCCTTCAGGGAGAACACACACATGGGGATGTGCGCGAAGAAGTTGTTGCTGAGGTTTAGCTTCCTCAG
TCTAGAGAGGTCGGCGAAGCATGCAGGGAGCTGGGACAGGCAGTTGTGCGACAAGCTCAGGACCTCCAGC
TTTCGGCACAAGCTCAGCTCGGCCGGCACCTCTGTCAGGCAGTTCATGTTGACAAACAGGACCTTGAGGC
ACTGTAGGAGGCTCACTTCTCTGGGCAGGCTCTTCAGGCGGTTCCCGCACAAGTTCAGGACCACGATCCG
GGTCAGTTTCCCCACCTCGGGGAGGGAGAACCCCGGAGCTGGTTGTGAGACAAATTGAGTTTCTGGACCC
CCGAAAAGCCCCCACAAAAAGCCG