1-BIN-301, 2-AIN-501 Methods in Bioinformatics, 2021/22

Introduction · Rules · Tasks and dates · Materials · Moodle · Discussion
Cvičenia vo štvrtok o 14:00 sú určené pre študentov BIN, INF, mINF, mAIN, DAV. Cvičenia vo štvrtok o 17:20 sú pre študentov z PriFUK a z fyzikálnych odborov. Obidvoje cvičenia sa budú konať už v prvom týždni semestra.


CB11: Rozdiel medzi revíziami

Z MBI
Prejsť na: navigácia, hľadanie
(Uniprot)
 
(One intermediate revision by the same user not shown)
Riadok 44: Riadok 44:
  
  
 +
 +
==PSI BLAST==
 +
* Toto cvičenie je z časti inšpirované stránkou [http://www.ncbi.nlm.nih.gov/Class/FieldGuide/problem_set.html]
 +
* Budeme uvažovať vzdialene podobné enzýmy
 +
** Bis(5'-adenosyl)-triphosphatase ([http://www.uniprot.org/uniprot/P49789 Uniprot])
 +
** Galactose-1-phosphate uridylyltransferase (GALT/GAL7) ([http://www.uniprot.org/uniprot/P31764 Uniprot])
 +
** Ich domény patria v databáze Pfam do toho istého klanu
 +
* Skúsme nájsť túto podobnosť v BLASTe: http://blast.ncbi.nlm.nih.gov/ v časti proteíny, zvoľme databázu Swissport, ako Query zadajme Accesion nášho proteínu P49789, spustime program PSI-BLAST
 +
* V prvom kole PSI-BLAST spúšťa bežný BLASTP
 +
* GAL gén (konkrétne GAL7_HAEIN, accession P31764) sa nachádza medzi výsledkami, ale má príliš vysokú E-value
 +
* Spustíme teraz druhú iteráciu PSI-BLAST, ktorá zostaví profil z proteínov s nízkou E-value v prvej iterácii
 +
* Aká je E-value nájdeného zarovnania?
 +
* Ak by výpočet dlho trval, výsledky sú tu: [http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb08/psi-blast1.html 1. kolo], [http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb08/psi-blast2.html 2. kolo]
  
 
==Expresia génov==
 
==Expresia génov==
Riadok 70: Riadok 83:
 
* Yeast genome database SGD obsahuje pomerne podrobne stranky pre jednotlive transkripcne faktory
 
* Yeast genome database SGD obsahuje pomerne podrobne stranky pre jednotlive transkripcne faktory
 
* Pozrime si stranku pre transkripcny faktor GAL4 [http://www.yeastgenome.org/locus/S000006169/regulation]
 
* Pozrime si stranku pre transkripcny faktor GAL4 [http://www.yeastgenome.org/locus/S000006169/regulation]
 
==PSI BLAST==
 
* Toto cvičenie je z časti inšpirované stránkou [http://www.ncbi.nlm.nih.gov/Class/FieldGuide/problem_set.html]
 
* Budeme uvažovať vzdialene podobné enzýmy
 
** Bis(5'-adenosyl)-triphosphatase ([http://www.uniprot.org/uniprot/P49789 Uniprot])
 
** Galactose-1-phosphate uridylyltransferase (GALT/GAL7) ([http://www.uniprot.org/uniprot/P31764 Uniprot])
 
** Ich domény patria v databáze Pfam do toho istého klanu
 
* Skúsme nájsť túto podobnosť v BLASTe: http://blast.ncbi.nlm.nih.gov/ v časti proteíny, zvoľme databázu Swissport, ako Query zadajme Accesion nášho proteínu P49789, spustime program PSI-BLAST
 
* V prvom kole PSI-BLAST spúšťa bežný BLASTP
 
* GAL gén (konkrétne GAL7_HAEIN, accession P31764) sa nachádza medzi výsledkami, ale má príliš vysokú E-value
 
* Spustíme teraz druhú iteráciu PSI-BLAST, ktorá zostaví profil z proteínov s nízkou E-value v prvej iterácii
 
* Aká je E-value nájdeného zarovnania?
 
* Ak by výpočet dlho trval, výsledky sú tu: [http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb08/psi-blast1.html 1. kolo], [http://compbio.fmph.uniba.sk/vyuka/mbi-data/cb08/psi-blast2.html 2. kolo]
 

Aktuálna revízia z 13:36, 9. december 2021

Populacna genomika v UCSC genome browseri

Zopar zaujimavych polymorfizmov v ludskom genome

  • SNP rs1815739 CC: SNPedia, genome browser
  • SNP rs12255372 GT: SNPedia, genome browser
  • SNP rs2472297 TT: SNPedia, genome browser
  • Ďalšie zaujímavé SNPy: rs10427255 CC, rs671 GG, rs713598 GG, rs17822931 CT, rs4988235 CC, rs1042725 CC, rs7495174 AA, rs1426654 AA, rs4481887 AG
  • V browseri si vsimnite tracky (specificke pre verziu genomu hg19):
    • HGDP Allele Freq s mapou sveta s distribuciou alel
    • Genome Variants obsahuje genomy niekolkych ludi, napr Jima Watsona
    • Takisto sa da pozriet genom ludi z jaskyne Denisova a Neandertalcov

UCSC genome browser ma aj dalsie tracky tykajuce sa populacnej genomiky a polymorfizmov

  • Pozrime si napriklad region chr2:46,570,000-46,630,000 v hg38
  • V casti Phenotype and Disease Associations
    • napr. ClinGen CNVs a ClinVar Variants obsahuju asociacie variantov k chorobam
    • GWAS Catalog sú výsledky GWAS štúdií


V starsej verzii ludskeho genomu hg18 je aj trojuholnikovy graf vazbovej nerovnovahy

  • region chr2:164,862-426,468 v hg18
  • zapnite "HapMap LD Phased" na Full (cast Variation and Repeats)
  • vsimnite si, ze miery LD sa medzi ludskymi podpopulaciami lisia (YRI: Nigeria; CEU: Europa; JPT+CHB: Japonsko, Cina)

RNA štruktúra

  • Znama databaza rodin RNA genov je Rfam: http://rfam.xfam.org/
  • Najdite si v nej rodinu RF00015 (U4 spliceosomal RNA)
  • V casti Secondary structure si mozete pozriet obrazky farebne kodovane podla roznych kriterii
    • Skuste pochopit, co jednotlive obrazky a ich farby znamenaju
  • Jedna z mnohych ludskych kopii je tato:
AGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCG
ATTATTGCTAATTGAAAACTTTTCCCAATACCCCGCCATGACGACTTGAA
ATATAGTCGGCATTGGCAATTTTTGACAGTCTCTACGGAGA
  • Skuste ju najst v ludskom genome nastrojom BLAT v UCSC genome browseri
  • Pozrite si tracky GENCODE genes, conservation, RepeatMasker v jej okoli
  • Vo verzii hg19 (kam sa viete z inej verzii dostat cez horne menu View->In Other Genomes) je track "CSHL Sm RNA-seq" ktory obsahuje RNASeq kratkych RNA z roznych casti buniek, zapnite si v jeho nastaveniach aj zobrazenie RNA z jadra (nucleus)
  • Zadajte sekvenciu na RNAfold serveri [1]
  • Ak vypocet dlho trva, pozrite si vysledok tu
  • Podoba sa na strukturu zobrazenu v Rfame? v com sa lisi?


PSI BLAST

  • Toto cvičenie je z časti inšpirované stránkou [2]
  • Budeme uvažovať vzdialene podobné enzýmy
    • Bis(5'-adenosyl)-triphosphatase (Uniprot)
    • Galactose-1-phosphate uridylyltransferase (GALT/GAL7) (Uniprot)
    • Ich domény patria v databáze Pfam do toho istého klanu
  • Skúsme nájsť túto podobnosť v BLASTe: http://blast.ncbi.nlm.nih.gov/ v časti proteíny, zvoľme databázu Swissport, ako Query zadajme Accesion nášho proteínu P49789, spustime program PSI-BLAST
  • V prvom kole PSI-BLAST spúšťa bežný BLASTP
  • GAL gén (konkrétne GAL7_HAEIN, accession P31764) sa nachádza medzi výsledkami, ale má príliš vysokú E-value
  • Spustíme teraz druhú iteráciu PSI-BLAST, ktorá zostaví profil z proteínov s nízkou E-value v prvej iterácii
  • Aká je E-value nájdeného zarovnania?
  • Ak by výpočet dlho trval, výsledky sú tu: 1. kolo, 2. kolo

Expresia génov

NCBI Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/

  • Databaza gene expression dat na NCBI
  • Do Search okienka zadajme GDS2925
  • Mali by sme dostat dataset Various weak organic acids effect on anaerobic yeast chemostat cultures
  • Mozeme si pozriet zakladne udaje, napr. citation, platform
  • Link "Expression profiles" nam zobrazi grafy pre rozne geny
  • Pri kazdom profile mozeme kliknut na profile neighbors, aby sme videli geny s podobnym profilom
  • Data analysis tools, cast Cluster heatmaps, K-means, skuste rozne pocty clustrov
    • napr. K=4 a K=5 pre Pearsonovu korelaciu
    • mozeme is pozriet aj hierarchicke zhlukovanie

Sekvenčné motívy, program MEME

  • Vazobne miesta transkripcnych faktorov sa casto reprezentuju ako sekvencne motivy
  • Ak mame skupinu sekvencii, mozeme hladat motiv, ktory maju spolocny
  • Znamy program na tento problem je MEME
  • Chodte na stranku http://meme-suite.org/
  • Zvolte nastroj MEME a v casti Input the primary sequences zvolte Type in sequences a zadajte tieto sekvencie
  • Pozrite si ostatne nastavenia. Co asi robia?
  • Ak server pocita dlho, mozete si pozriet vysledky tu

Kvasinkové transkripčné faktory v SGD

  • Yeast genome database SGD obsahuje pomerne podrobne stranky pre jednotlive transkripcne faktory
  • Pozrime si stranku pre transkripcny faktor GAL4 [3]