HERD.InputOutput History
Hide minor edits - Show changes to output
Changed line 34 from:
Each description of the state begins with the line with four numbers: the number of the state, the row of the state, the column of the state and the type of the state (the last three values are important only to jumping HMM).
to:
Each description of the state begins with the line with four numbers: the number of the state, the row of the state, the column of the state and the type of the state (the last three values are important only to jumping HMM). The next two line contains the emissions probabilities and log of the emission probabilities (the number of emissions and the emissions). The next line contains the number of transitions and the rest of the state description is followed by the description of transitions: initial state, final state, probability, log of the probability.
Changed lines 34-35 from:
Each description of the state begins with the line with four numbers: the number of the state, the row of the state, the column of the state and the type of the state (the last three values are important only to jumping HMM). The next line contains the number of
the
to:
Each description of the state begins with the line with four numbers: the number of the state, the row of the state, the column of the state and the type of the state (the last three values are important only to jumping HMM).
Changed lines 32-34 from:
line follows $n$ description of the states.
Each description
to:
line follows $n$ description of the states.
Each description of the state begins with the line with four numbers: the number of the state, the row of the state, the column of the state and the type of the state (the last three values are important only to jumping HMM). The next line contains the number of
the
Added lines 38-100:
Example:
9 2
0 0 0 0
0
0
1
0 1 1 0
1 0 0 0
2 0.5 0.5
2 -0.69314718055994530941 -0.69314718055994530941
2
1 1 0.95 -0.05129329438755053342
1 2 0.05 -2.99573227355399099343
2 1 0 0
2 0 1
2 -inf 0
2
2 3 0.9 -0.10536051565782630122
2 8 0.1 -2.30258509299404568401
3 1 0 0
2 0 1
2 -inf 0
1
3 4 1 0
4 1 0 0
2 0.1 0.9
2 -2.30258509299404568401 -0.10536051565782630122
2
4 4 0.95 -0.05129329438755053342
4 5 0.05 -2.99573227355399099343
5 1 0 0
2 0.1 0.9
2 -2.30258509299404568401 -0.10536051565782630122
2
5 5 0.9 -0.10536051565782630122
5 6 0.1 -2.30258509299404568401
6 1 0 0
2 0 1
2 -inf 0
1
6 7 1 0
7 1 0 0
2 0 1
2 -inf 0
1
7 1 1 0
8 1 0 0
0
0
0
2
0 e
1 i
Added lines 23-27:
Example:
ACTCGCTAGCTAGTCGATGCT
GCTAGCTAGTCGTAGCTAGTCGTACGT
GCTAGTCAGTCGATGCTAGTCAGCTAGTCAGTCGATGCTAGC
Added lines 11-18:
Example:
2 4
1 0.9 0.8 0.7 0.6
1 0.9 0.3 0.2 0.01
5 3 0 0
5 2 1 1
5 4 10000 0
Added lines 15-21:
The first line of the input contains the numbers, the number of states $N$ and the number of colors $C$. The first
line follows $n$ description of the states.
Each description
After the description of the states, there is the number X and the next X lines contains the pairs (number of the color, label of the color).
Changed line 12 from:
One sequence per input file.
to:
Changed line 12 from:
to:
One sequence per input file.
Changed lines 4-9 from:
to:
The first line of the input contains two numbers, the number of functions $F$ and the maximum value of the window-size $W$.
Next $F$ lines contains $W+1$ real numbers that describes the weight function of the HERD algorithm. The function in $i$-th
function have number $i$. The function with number $0$ is the constant function $f(i)=1$.
The rest of the input contain the description of the runs, one line per line. The run is described by four numbers: the window-size, penalty $\gamma$, posterior weight $\beta$ and the number of weighting function.
Added lines 11-12:
Changed lines 3-9 from:
!File with parameters
!Input sequences
!HMM file
!Output format
to:
!!File with parameters
!!Input sequences
!!HMM file
!!Output format
Added lines 1-9:
(:title Input and output formats:)
!File with parameters
!Input sequences
!HMM file
!Output format